p62/SQSTM1 and Nrf2 are essential for exercise‐mediated enhancement of antioxidant protein expression in oxidative muscle

ABSTRACT

Increased muscle contractile activity, as observed with regular exercise, prevents oxidative stress—induced muscle wasting, at least partially, by improving the antioxidant defense system. Phosphorylated p62/sequestosome1 competitively binds to the Kelch‐like ECH‐associated protein 1, activating nuclear factor erythroid 2—related factor 2 (Nrf2), which stimulates transcription of antioxidant/electrophile responsive elements. However, it remains to be determined if this process is activated by regular exercise in skeletal muscle. Here, we demonstrate that muscle contractile activity increases antioxidants, Nrf2 translocation into nuclei, and Nrf2 DNA‐binding activity in association with increased p62 phosphorylation (Ser351) in mouse oxidative skeletal muscle. Skeletal muscle‐specific loss of Nrf2 [i.e., Nrf2 muscle‐specific knockout (mKO) mice] abolished the expression of the Nrf2 target antioxidant gene NAD(P)H‐quinone oxidoreductase 1 (NQO1) in both glycolytic and oxidative muscles but reduced exercise‐mediated increases of antioxidants (i.e., copper/zinc superoxide dismutase (SOD) and extracellular SOD only in oxidative muscle. Interestingly, skeletal muscle—specific loss of p62 (i.e., p62 mKO mice) also abolished the expression of NQO1 and reduced exercise‐mediated increases of the same antioxidants in soleus muscle. Collectively, these findings indicate that p62 and Nrf2 cooperatively regulate the exercise‐mediated increase of antioxidants in oxidative muscle.—Yamada, M., Iwata, M., Warabi, E., Oishi, H., Lira, V. A., Okutsu, M. p62/SQSTM1 and Nrf2 are essential for exercise‐mediated enhancement of antioxidant protein expression in oxidative muscle. FASEB J. 33, 8022–8032 (2019). www.fasebj.org

ABBREVIATIONS

ARE/EpRE

antioxidant/electrophile responsive element

CuZnSOD

copper/zinc SOD

EcSOD

extracellular SOD

EGFP

enhanced green fluorescent protein

Keap1

Kelch‐like ECH‐associated protein 1

LC3

light chain 3

mKO

muscle‐specific knockout

mlc1f

myosin light chain 1 fast

MnSOD

manganese SOD

NQO1

NAD(P)H‐quinone oxidoreductase 1

Nrf2

nuclear factor erythroid 2‐related factor 2

SOD

superoxide dismutase

tBHQ

tert‐butylhydroquinone

WT

wild type

Skeletal muscle atrophy is a hallmark of aging and several debilitating diseases (e.g., cancer, congestive heart failure, chronic kidney disease, and chronic obstructive pulmonary disease) that contribute to morbidity and mortality (1). Oxidative stress, which is caused by excessive production of reactive oxygen species and/or reduced antioxidant defenses, plays an important role in skeletal muscle atrophy in these situations (2). Thus, increased antioxidant expression could be a potentially protective measure against oxidative stress and skeletal muscle atrophy in a variety of conditions. However, the regulation of antioxidant protein expression in skeletal muscle is not well understood.

The Kelch‐like ECH‐associated protein 1 (Keap1)‐nuclear factor erythroid 2–related factor 2 (Nrf2) signaling pathway is a major molecular mechanism that regulates cellular defenses against oxidative stress (3). In fact, Nrf2 regulates the expression of a set of cytoprotective antioxidant genes, such as NAD(P)H‐quinone oxidoreductase 1 (NQOl), glutathione S‐transferase, and superoxide dismutase (SOD). Under basal and non‐stressed conditions, Nrf2 translocation to the nucleus is prevented by its physical interaction with Keap1 in the cytoplasm, which leads to its rapid degradation by the ubiquitin‐proteasome system (4, 5). In contrast, under stressful conditions, Nrf2 dissociates from Keap1, translocates to the nucleus, forms heterodimers with small musculoaponeurotic fibrosarcomas, and binds to the antioxidant/electrophile responsive element (ARE/EpRE) (6, 7)—a cis‐acting element in the promoter region of target genes.

It is well known that chronically elevated muscle contractile activity, as observed with regular endurance exercise, leads to improved antioxidant defense in skeletal muscle, increasing the expression of cytoprotective antioxidant genes, such as NQO1, copper/zinc SOD (CuZn‐SOD, also known as SOD1), manganese SOD (MnSOD, also known as SOD2), and extracellular SOD (EcSOD, also known as SOD3) (8–10). Interestingly, recent studies have demonstrated that muscle contraction increases Nrf2 expression in skeletal muscle (8, 11, 12) and that exhaustive exercise leads to nuclear Nrf2 accumulation and enhanced binding activity to ARE/EpRE in cardiomyocytes (13). However, the following remains to be determined in skeletal muscle: 1) whether Nrf2 is required for increased antioxidant expression caused by regular exercise, and 2) the molecular mechanism of Nrf2 nuclear translocation during exercise.

Here, using tissue‐specific gene deletions in mice and in cultured myotubes, we report that Nrf2 is required for normal antioxidant expression resulting from regular exercise and that p62/sequestosomel, shown to stimulate Nrf2 nuclear translocation and transcriptional activity by disrupting its binding to Keap1 in other cell types (14, 15), plays an essential role in these adaptations.

MATERIALS AND METHODS

Animals

Male C57BL/6J mice were obtained from Japan SLC (Shizuoka, Japan) and were studied at 10 wk old. Nrf2 muscle‐specific knockout (mKO) and p62 mKO mice were generated by mice bearing a floxed Nrf2 allele (Nrf2 fl/fl) (16) or a floxed p62 allele (p62 fl/fl) (17) crossed with transgenic mice expressing Cre under the control of a myosin light chain 1 fast promoter (mlc1f‐Cre). Mlc1f‐Cre activity has been detected in glycolytic and oxidative muscle but not in the heart (18). Nrf2 mKO and p62 mKO mice were studied at 12 wk of age and their results were compared with wild‐type (WT) littermates. The animals were provided access to food and drinking water ad libitum. After animals were euthanized, tonic oxidative soleus, plantaris, tibialis anterior, and gastrocnemius with mixed fiber types, and phasic glycolytic white vastus lateralis and extensor digitorum longus muscles were subsequently harvested for analysis. All of the experimental procedures were carried out with the approval from the Ethical Committee of Nagoya City University (H26M‐71).

Genotyping

Mouse DNA was isolated following a phenol‐chloroform—based DNA extraction protocol and used for PCR with primers for the Cre allele, the loxP‐flanked Nrf2 allele, and the loxP‐flanked p62 allele. Reactions consisted of 1 min of initial denaturation at 94°C, 35 cycles of denaturation (98°C for 5 s), annealing (55°C for 5 s), and extension (72°C for 10 s), and a final 3 min extension at 72°C. PCR products were resolved through electrophoresis on a 2% agarose gel containing AtlasSight DNA Stain (BioAtlas, Tartu, Estonia), followed by image acquisition with an ImageQuant LAS 500 (GE Healthcare, Chicago, IL, USA). Mice with a genotype of Nrf2^+/+:mlc1f‐Cre^+/− were considered WT, and mice with a genotype of Nrf2 fl/fl:mlc1f‐Cre^+/− were considered Nrf2 mKO mice. Mice with a genotype of p62^+/+: mlclf‐Cre^+/− were considered WT, and mice with a genotype of p62 fl/fl: mlclf‐Cre^+/− were considered p62 mKO mice. Mice genotypes were confirmed by Western blot or semiquantitative RT‐PCR analysis.

Acute exercise and exercise training

To measure Nrf2 translocation and Nrf2 DNA‐binding activity, mice were allowed to participate in acute exercise on the treadmill starting with a speed of 13.4 m/min and 5% incline. The speed was increased by 2.7 m/min every 30 min until 2 h after starting the exercise. Muscles were harvested immediately after exercise. To measure antioxidant and other protein expression, mice in the exercise group had access to a running wheel in their cage and were allowed to voluntarily run for 4 wk, whereas mice in the sedentary group were maintained in cages without access to running wheels. Running activity was monitored wirelessly (Med Associates, Fairfax, VT, USA) and continually during the intervention. Running wheels were removed from cages 24 h before euthanization and harvest of muscle samples to avoid any potential confounding effects of any last bouts of exercise.

Treadmill running test

Mice were acclimatized to treadmill running for 3 d (13.4 m/min, 10 min). On the fourth day, animals were tested on the treadmill starting with a speed of 13.4 m/min and 5% incline. The speed was increased by 2.7 m/min every 30 min until reaching a speed of 26.8 m/min. A paper towel located at the end of the treadmill was used to encourage the animals to run, and the test was terminated when a mouse stopped responding to continuous tail brushing for 20 s.

Grip strength test

A grip strength test was performed at the end of the training period using a grip strength meter (GPM‐101B; Melquest, Toyama, Japan) according to the manufacturer's instructions. Each mouse was tested using 10 trials with 10‐s intervals. The mean value of the 3 highest readings was used for statistical analysis.

Cell culture of C2C12 myotubes

In order to evaluate the effects of cyclic mechanical stretch, C2C12 myoblasts were plated and differentiated into myotubes in an elastic silicone chamber. Myotubes were stretched (110% of their original length at 1 Hz) for 1, 6, or 24 h using an NS‐200 apparatus (Strex, Osaka, Japan) driven by a computer‐controlled stepping motor, as previously described (19). To overexpress mouse p62 protein, pcDNA3.1‐p62 plasmids were transfected into C2C12 myotubes with a NEPA21 electroporator (Nepa Gene, Ichikawa, Japan) according to the manufacturer's instructions. To confirm transfection efficiency, pCAGGS—enhanced green fluorescent protein (EGFP) plasmids were cotransfected with pcDNA3.1‐p62 plasmids in C2C12 cells. Transfection assays were repeated twice in independent experiments, each containing at least duplicate samples. C2C12 myotubes were also cultured with tert‐butylhydroquinone (tBHQ) or bafilomycin as positive controls for Nrf2 or phosphorylated p62. Cells were subsequently harvested for mRNA and protein analysis.

Isolation of nuclear and cytoplasmic fractions

Nuclear and cytoplasmic fractions from sedentary and exercised soleus muscles were used in assays monitoring Nrf2 nuclear translocation and Nrf2 DNA‐binding activity. Essentially, whole soleus muscles were gently glass‐on‐glass homogenized in hypotonic buffer [containing 20 mM 4‐(2‐hydroxyethyl)‐1‐piperazineethanesulfonic acid, 5 mM sodium fluoride, 10 µM sodium molybdate, 0.1 mM EDTA, pH 7.5] on ice. Homogenized samples were transferred to microtubes and incubated for 15 min on ice before 10% Noniet P‐40 (0.5% final) was added. Samples were then vortexed vigorously for 10 s and centrifuged at 12,000 g for 30 s at 4°C. Supernatants containing the cytoplasmic fraction were transferred to prechilled microtubes. Complete lysis buffer (Active Motif, Carlsbad, CA, USA) was added to the nuclear pellets and incubated for 30 min on ice, after which samples were centrifuged at 14,000 g for 10 min at 4°C. The resulting supernatant was analyzed as the nuclear fraction.

Western blot analysis

To assess protein expression in skeletal muscle, whole muscles harvested from mice were homogenized in sample lysis buffer on ice using a glass‐on‐glass homogenizer as previously described (20). To assess whether mechanical stretch regulates protein expression in C2C12, the myotubes were rinsed twice in ice‐cold PBS and scraped in RIPA buffer (Cell Signaling Technology, Danvers, MA, USA) on ice. All buffers contained protease and phosphatase inhibitors (10). Supernatants were centrifuged at 12,000 g for 3 min and subsequently assayed for protein concentration using the DC protein assay (Bio‐Rad, Hercules, CA, USA). Cellular lysates (20 or 40 µg) and muscle homogenates (40 µg) were separated by PAGE and transferred overnight at 4°C to PVDF membranes for Western blotting. As verification of equal loading and transfer, the membrane was stained with Ponceau S and subsequently probed and normalized to β‐actin. Immunoblot analysis was performed with the following primary antibodies: CuZnSOD (ab16831; Abcam, Cambridge, United Kingdom), MnSOD (ab13534; Abcam), EcSOD (AF4817; R&D Systems, Minneapolis, MN, USA), NQO1 (NB100‐1005; Novus Biologicals, Centennial, CO, USA), p62 (p0067; MilliporeSigma, Burlington, MA, USA), phospho‐p62 Ser351 (PM074; MBL Life Science, Nagoya, Japan), phospho‐p62 Ser403 (D343, MBL Life Sciences, which recognizes mouse p62 phosphorylation at Ser405), Nrf2 (16396‐1‐AP; Proteintech, Rosemont, IL, USA), Keap1 (10503‐2‐AP; Proteintech), microtubule‐associated protein light chain 3 (LC3) A/B (4108; Cell Signaling Technology), and β‐actin (4967; Cell Signaling Technology). Immunoblots were analyzed by ImageQuant LAS 500 and quantified by ImageJ software (National Institutes of Health, Bethesda, MD, USA).

IMrf2 DNA‐binding activity assay

Nrf2 DNA‐binding activity was measured using a Trans‐AM Nrf2 Assay Kit following the manufacturer's protocol (Active motif). Essentially, complete binding buffer was mixed with 10 µg of nuclear protein and incubated for 1 h at room temperature with mild agitation. The provided nuclear extract and complete binding buffer were used as positive and blank controls, respectively. After the incubation, Nrf2 antibody was added to each well and incubated for 1 h, followed by incubation with an horseradish peroxidase–conjugated secondary antibody for 1 h. Developing solution was added to each well and incubated at room temperature until the blue color turned medium to dark blue. Stop solution was added, and absorbance was read on a spectrophotometer (FilterMax F3; Molecular Devices, San Jose, CA, USA) at 450 nm.

Semiquantitative RT‐PCR

To assess mRNA expression in Nrf2 mKO mice, p62 mKO mice, and stretched C2C12 myotubes, total RNA was isolated from plantaris muscle and C2C12 myotubes with Trizol (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions (21). Reverse transcription was performed with 2.5 µg of total RNA using a SuperScript II First‐Strand Synthesis System for RT‐PCR (Thermo Fisher Scientific). Semi‐quantitative RT‐PCR analysis was then used to assess Nrf2, p62, Keap1, and 18S mRNA. The following PCR primers were used: Nrf2: 5′‐AGGTTGCCCACATTCCCAAA‐3′ and 5′‐GACCACAGTTGCCCACTTCT‐3′; p62: 5′‐TGGCCACCTCTCTGATAGCT‐3′ and 5′‐TCCCGACTCCATCTGTTCCT‐3′; Keap1: 5′‐GATGGGCAGGACCAGTT‐3′ and 5′‐CCTGTTGTCAGTGCTCA3′; 18S: 5′‐GTTGGTGGAGCGATTTGTCT‐3′ and 5′‐GGCCTCACTAAACCATCCAA‐3′. Template denaturation was performed at 94°C for 5 min followed by 30 (Nrf2), 27 (p62), 27 (Keap1), or 18 (18S) cycles consisting of 30 s at 94°C, 30 s at 60°C, and 40 s at 72°C. PCR products were separated by electrophoresis on a 2% agarose gel and stained with AtlasSight DNA Stain (BioAtlas). Gels were analyzed using an ImageQuant LAS 500 and quantified using ImageJ software. Results were normalized with 18S mRNA and presented as fold‐changes compared with WT mice or unstretched C2C12 myotubes.

Hematoxylin and eosin staining

Tibialis anterior muscle were harvested and frozen in liquid nitrogen—cooled isopentane. Cross sections (8 µm) of the tibialis anterior muscle were stained with eosin Y working solution (MilliporeSigma), rinsed with distilled water, and counterstained with Mayer's hematoxylin (Muto Pure Chemicals, Tokyo, Japan). Sections were rinsed again with distilled water, dehydrated in ethanol, and mounted on slides with mounting medium as previously described. Images were acquired with a DS‐Fi1 digital camera (Nikon, Tokyo, Japan) coupled to a BX43 optical microscope (Olympus, Tokyo, Japan).

Statistical analysis

A Student's t test and 2‐way ANOVA were used for statistical analyses. The 2‐way ANOVA was followed by a Tukey‐Kramer post hoc test, as applicable. Values of P < 0.05 were considered statistically significant, and data are presented as the mean values ± se.

RESULTS

Muscle contractile activity increases antioxidants associated with Nrf2 activation

Expression of antioxidant proteins, such as CuZnSOD, MnSOD, EcSOD, and NQO1 was significantly higher in the tonic oxidative soleus muscle when compared to the phasic glycolytic white vastus lateralis muscle in C57BL/6J mice (Fig. 1A, B). Voluntary wheel running led to significant increased expression of these antioxidant proteins in the mixed fiber containing plantaris muscle (Fig. 1C, D). Because a major mechanism in the regulation of antioxidants is a transcriptional activation of the ARE/EpRE by Nrf2, we measured Nrf2 and Keap1 protein expression in skeletal muscle. The Nrf2 and Keap1 protein expression in soleus muscle was significantly higher than in white vastus lateralis muscle (Fig. 1E, F). To determine whether muscle contractile activity regulates Nrf2 activity in skeletal muscle cells, we measured Nrf2 and Keap1 mRNA expression in C2C12 myotubes upon cyclic mechanical stretch, a model that mimics contraction in vitro (19), and found that 6 h of stretch significantly increased Nrf2 and Keap1 mRNA (Supplemental Fig. S1A, B). We also found that 4 wk of voluntary wheel running leads to significantly increased Nrf2 and Keap1 protein expression in plantaris muscle (Fig. 1G, H). In addition, maximal treadmill running was used to assess the acute effect of an exercise bout on Nrf2 nuclear translocation and activation (i.e., DNA‐binding activity). We found a ∼2‐fold increase in nuclear levels of Nrf2 accompanied by a ∼50% increase of Nrf2 activation in the soleus muscle of exercised mice (Fig. 1I–K).

Figure 1

Muscle contractile activity increases antioxidant protein expression associated to Nrf2 activation. A) Representative immunoblot images of antioxidant protein expression in phasic glycolytic white vastus (WV) lateralis and tonic oxidative soleus (SO) muscles of sedentary mice. B) Quantification of antioxidant protein expression in WV and SO muscles of sedentary mice. C) Representative immunoblot images of antioxidant protein expression in mixed fiber containing plantaris (PL) muscle of sedentary (Sed) and exercise‐trained (Ex) mice. D) Quantification of antioxidant protein expression in PL muscles of Sed and Ex mice. E) Representative immunoblot images of Nrf2, Keap1, and β‐actin protein expression in WV and SO muscles of Sed mice. F) Quantification of Nrf2 and Keap1 protein expression in WV and SO muscles of Sed mice. G) Representative immunoblot images of Nrf2 and Keap1 protein expression and Ponceau in PL muscle of Sed and Ex mice. tBHQ nuclear extraction from tBHQ‐treated C2C12 myoblast. H) Quantification of Nrf2 and Keap1 protein expression in PL muscle of Sed and Ex mice. I) Representative immunoblot images of nuclear and cytoplasmic Nrf2 protein and Ponceau in SO muscle from Sed and acute exercised (AE) mice. J) Quantification of nuclear and cytoplasmic Nrf2 protein in SO muscle from Sed and AE mice. K) Nrf2 activation (i.e., DNA‐binding activity) in Sed and AE mice in SO muscle (n = 7–13/group). Protein expression comparisons were performed after normalization to β‐actin or Ponceau. Results are represented as means ± se (n = 9–14/group, unless specified otherwise). *P < 0.05, **P < 0.01, ***P < 0.001.

NQ01 expression is abolished by Nrf2 deletion in skeletal muscle

To determine whether Nrf2 is required for contractile activity‐induced regulation of antioxidants in skeletal muscle in vivo, Nrf2 mKO mice were generated by crossing Nrf2 fl/fl mice with mice expressing Cre recombinase under the control of mlc1f promoter (Mlclf‐Cre) (Fig. 2A). Mlc1f‐Cre is active in glycolytic and oxidative muscles but not in the heart (18). Nrf2 mKO clearly reduced Nrf2 mRNA expression in plantaris muscle compared to WT mice (Fig. 2B). A previous study has reported that the expression of the Nrf2 target antioxidant gene NQO1 was robustly impaired in Nrf2 global knockout mice compared to WT mice (22). Consistent with those findings, Nrf2 mKO mice had a markedly reduced expression of NQO1 protein in plantaris muscle compared to WT mice (Fig. 2C). Loss of Nrf2 in skeletal muscle did not affect body weight or gross myofiber structure in skeletal muscle (Fig. 2D, E). Grip strength and running capacity were also not affected by loss of Nrf2 in skeletal muscle (Fig. 2F, G).

Figure 2

Phenotype of Nrf2 mKO mice. A) RT‐PCR images for genotyping. B) Nrf2 mRNA expression in Nrf2 mKO and WT littermate mice in plantaris (PL) muscle. C) NQO1 protein expression in Nrf2 mKO and WT mice in PL muscle. D) Body weight in Nrf2 mKO and WT mice. E) Hematoxylin and eosin staining in Nrf2 mKO and WT mice in tibialis anterior muscle. Scale bar, 100 µm. F) Muscle force by grip strength in Nrf2 mKO and WT mice. G) Running distance by treadmill running test in Nrf2 mKO and WT mice. H) Daily voluntary running activity in Nrf2 mKO and WT mice during the 4 wk of exercise training. I) Representative running activity recording in Nrf2 mKO and WT mice during the 4 wk of voluntary running. J) Body weight in sedentary (Sed) and exercise‐trained (Ex) Nrf2 mKO and WT mice. K) Oxidative soleus (SO), mixed fiber type of PL and gastrocnemius (GA) muscle weight (normalized by body weight) in Sed and Ex Nrf2 mKO and WT mice. Results are represented as means ± se (n = 9–13/group).

Loss of skeletal muscle Nrf2 attenuates regular exercise‐mediated increases of antioxidants in the oxidative soleus muscle

To determine whether Nrf2 is required for enhanced antioxidant enzyme expression by muscle contractile activity, Nrf2 mKO and their WT littermates were allowed to voluntarily wheel run for 4 wk. Running distance was not significantly different between Nrf2 mKO and WT mice (Fig. 2H). The daily running distance in each genotype increased gradually, reaching a steady level after 2 wk (Fig. 2I). Regular exercise significantly decreased body weight to similar levels in Nrf2 mKO and WT mice (Fig. 2J). The soleus, plantaris, and gastrocnemius muscle weights were not affected by genotype or voluntary running (Fig. 2K). Interestingly, loss of skeletal muscle Nrf2 impaired exercise‐mediated increases of CuZnSOD and EcSOD expression in the oxidative soleus muscle (Fig. 3A, B) but did not affect exercise‐mediated increases of antioxidant enzymes in the glycolytic white vastus lateralis muscle (Fig. 3C, D).

Figure 3

Antioxidant protein expression in oxidative soleus (SO) and glycolytic white vastus lateralis (WV) muscle of sedentary (Sed) and exercise‐trained (Ex) Nrf2 mKO. A) Representative immunoblot images of antioxidant protein expression in Nrf2 mKO and WT littermate mice in SO muscle. B) Quantification of antioxidant protein expression in Nrf2 mKO and WT mice in SO muscle. C) Representative immunoblot images of antioxidant protein expression in Nrf2 mKO and WT mice in WV muscle. D) Quantification of antioxidant protein expression in Nrf2 mKO and WT mice in WV muscle. Protein expression comparisons were performed after normalization to β‐actin. Results are represented as means ± se (n = 9–13/group). *P < 0.05, ***P < 0.001.

Increased contractile activity enhances p62 protein expression and phosphorylation in C2C12 myotubes and oxidative muscle but not in glycolytic muscle

p62 competes with Nrf2 for Keap1 binding, and phosphorylation of p62 at Ser351 has been shown to enhance p62 affinity for Keap1 binding, thereby increasing Nrf2 nuclear translocation and activation (14). To determine whether increased phosphorylation of p62 in skeletal muscle cells is sufficient to increase antioxidant synthesis, we first overexpressed p62 in C2C12 myotubes. Transfection efficiency was confirmed by epifluorescence inspection of EGFP. Overexpression of p62 and enhanced p62 phosphorylation at Ser351 were evident in comparison with nontransfected (control) and EGFP‐transfected cells (Supplemental Fig. S2). Importantly, p62 overexpression increased the expression of CuZnSOD and NQO1 when compared with control and EGFP‐transfected cells (Supplemental Fig. S2). In order to evaluate the acute effects of increased contractile activity on p62 mRNA, protein expression and phosphorylation, C2C12 myotubes were subjected to cyclic mechanical stretch. Six hours of mechanical stretch significantly increased p62 mRNA levels (Supplemental Fig. S3A, B), whereas p62 expression and phosphorylation, at both Ser351 and Ser405, were significantly increased after 24 h of mechanical stretch (Supplemental Fig. S4A, B). In order to evaluate the chronic effects of increased muscle contractile activity in vivo, C57BL/6J mice were allowed to voluntarily wheel run for 4 wk, and p62 protein and phosphorylation in oxidative soleus and glycolytic white vastus lateralis muscles were assessed. Interestingly, regular endurance exercise training enhanced p62 protein expression and phosphorylation at both Ser351 and Ser405 in the soleus muscle, but not in the white vastus lateralis muscle (Fig. 4).

Figure 4

Enhanced muscle contractile activity increases p62 protein and phosphorylation in oxidative soleus (SO) muscle, but not in glycolytic white vastus lateralis (WV) muscle. A) Representative immunoblot images of p62 phosphorylation at Ser351 and at Ser405 and total p62 protein expression in SO and WV muscle in sedentary (Sed) and exercise‐trained (Ex) mice. B) Quantification of p62 phosphorylation at Ser351 and at Ser405 and total p62 protein expression in SO and WV muscle in Sed and Ex mice. Protein expression comparisons were performed after normalization to β‐actin. Results are represented as means ± se (n = 7–12/group). *P < 0.05, **P < 0.01, ***P < 0.001.

NQO1 expression is abolished by p62 deletion in skeletal muscle

To determine whether p62 is required for enhanced antioxidant enzyme expression by muscle contractile activity, p62 mKO mice were generated by crossing p62 fl/fl mice with mice expressing Cre recombinase under the control of mlc1f promoter (Fig. 5A). p62 mKO clearly reduced p62 mRNA expression in plantaris muscle compared with that in WT mice (Fig. 5B). Consistent with Nrf2 mKO mice, p62 mKO mice also demonstrated a marked decrease in NQO1 protein expression in plantaris muscle compared with that in WT mice (Fig. 5C). Loss of p62 in the skeletal muscle did not affect body weight or gross myofiber structure (Fig. 5D, E). Grip strength and running capacity were not affected by loss of p62 in skeletal muscle (Fig. 5F, G).

Figure 5

Phenotype of p62 mKO mice. A) RT‐PCR images for genotyping. B) p62 mRNA expression in p62 mKO and WT littermate mice in plantaris (PL) muscle. C) NQO1 protein expression in p62 mKO and WT mice in PL muscle. D) Body weight in p62 mKO and WT mice. E) Hematoxylin and eosin staining in p62 mKO and WT mice in tibialis anterior muscle. Scale bar, 100 µm. F) Muscle force by grip strength in p62 mKO and WT mice. G) Running distance by treadmill running test in p62 mKO and WT mice. H) Daily voluntary running activity in p62 mKO and WT mice during the 4 wk of voluntary running. I) Representative running activity recording in p62 mKO and WT mice during the 4 wk of voluntary running. J) Body weight in sedentary (Sed) and exercise‐trained (Ex) p62 mKO and WT mice. K) Oxidative soleus (SO), mixed fiber type of PL and gastrocnemius (GA) muscle weight (normalized by body weight) in Sed and Ex p62 mKO and WT mice. Results are represented as means ± se (n = 9–14/group).

Loss of skeletal muscle p62 attenuates regular exercise‐mediated increases in antioxidant enzymes in the oxidative soleus muscle

First, to determine whether p62 is required for enhanced antioxidant enzyme expression by muscle contractile activity, p62 mKO and their WT littermates were allowed to voluntarily wheel run for 4 wk. Running distance again reached a steady state level after 2 wk and was not significantly different between p62 mKO and WT mice (Fig. 5H, I). Regular exercise significantly decreased body weight, but no significant differences between p62 mKO and WT mice were observed (Fig. 5J). The soleus, plantaris, and gastrocnemius muscle weights were not affected by genotype or voluntary running (Fig. 5K). Consistent with the phenotype of Nrf2 mKO mice, loss of skeletal muscle p62 impaired exercise‐mediated increases of CuZnSOD and EcSOD expression in oxidative soleus muscle (Fig. 6A, B), but did not affect exercise‐mediated increases of antioxidant enzymes in the glycolytic white vastus lateralis muscle (Fig. 6C, D). Of note, these deficits in exercise‐mediated increase of antioxidant enzymes in skeletal muscle with loss of p62 were not associated with major impairments in autophagy. p62 mKO mice displayed similar baseline LC3‐I and LC3‐II autophagy protein expression levels when compared with WT littermates both at sedentary and trained conditions (Supplemental Fig. S5A, B).

Figure 6

Antioxidant protein expression in oxidative soleus (SO) and glycolytic white vastus lateralis (WV) muscle of sedentary (Sed) and exercise‐trained (Ex) p62 mKO mice and WT littermate mice. A) Representative immunoblot images of antioxidant protein expression in p62 mKO and WT littermate mice in SO muscle. B) Quantification of antioxidant protein expression in p62 mKO and WT mice in SO muscle. C) Representative immunoblot images of antioxidant protein expression in p62 mKO and WT mice in WV muscle. D) Quantification of antioxidant protein expression in p62 mKO and WT mice in WV muscle. Protein expression comparisons were performed after normalization to β‐actin. Results are represented as means ± se (n = 9–14/group). *P < 0.05, **P < 0.01, ***P < 0.001.

DISCUSSION

Chronic muscle contractile activity, as observed with regular endurance exercise, increases antioxidant enzyme expression in skeletal muscle. Expression of antioxidant enzymes requires Nrf2 translocation into nuclei and transcriptional transactivation of ARE/EpRE genes. Recent studies have reported that muscle contraction increases Nrf2 expression and stimulates Nrf2 translocation into nuclei of skeletal muscle fibers (8, 11, 12), suggesting that Nrf2 expression and translocation by exercise training may regulate antioxidant enzyme levels in skeletal muscle. However, it was not clear whether Nrf2 translocation is required for regular exercise‐mediated increase in antioxidant proteins in skeletal muscle. Here, we demonstrated that exercise increases Nrf2 protein, its nuclear translocation, and DNA‐binding activity in oxidative soleus muscle. In addition, we also demonstrated that loss of skeletal muscle Nrf2 (i.e., in Nrf2 mKO mice) impairs regular exercise‐mediated increase in the expression of CuZnSOD and EcSOD in the oxidative soleus muscle but not in the glycolytic white vastus lateralis muscle. These findings collectively indicate that Nrf2 is required for normal endurance exercise‐mediated increase of antioxidant enzyme levels in oxidative muscle.

Although our findings demonstrated that exercise increases Nrf2 nuclear translocation and DNA‐binding activity in oxidative soleus muscle, the cellular and molecular mechanisms involved were incompletely understood. Here, we focused on p62, a protein involved in multiple cellular functions including signal transduction as well as degradation of proteins and organelles (23, 24). p62 function has been found to be modulated by multiple phosphorylation events. Phosphorylation of human p62 at Ser403 (equivalent to Ser405 in mouse p62) increases its affinity for polyubiquitin chains, enhancing its adaptor role in ubiquitinated protein degradation (25). Phosphorylation of p62 at Ser351 increases its affinity for Keap1 causing Nrf2 dissociation and nuclear translocation (25). Of note, in hepatocellular carcinoma cells, p62 is constitutively phosphorylated at Ser351, causing continuous activation of Nrf2 to prevent oxidative stress (14). Therefore, in the present study, we hypothesized that Ser351 phosphorylation of p62 would be involved in the nuclear translocation and activation of Nrf2 in response to exercise in skeletal muscle. Accordingly, we found that increased muscle contractile activity induces p62 phosphorylation at Ser351 both in vitro and in vivo, suggesting that this event is involved in Nrf2‐dependent increase of antioxidant gene expression with exercise in muscle.

To further determine the degree to which Nrf2, and potentially p62, was required for exercise‐mediated increase of antioxidant enzyme expression in skeletal muscle, we established the Nrf2 mKO and p62 mKO mice. Consistent with Nrf2 global knockout mice (22), Nrf2 mKO mice had a marked reduction in NQO1 protein expression compared with that of WT littermates and also an attenuated regular exercise‐mediated increase of CuZnSOD and EcSOD in the oxidative soleus muscle. Interestingly, these features were phenocopied by loss of p62 in the soleus muscle (i.e., in p62mKO mice). Importantly, p62 gain‐of‐function in C2C12 myotubes was accompanied by enhanced p62 phosphorylation at Ser351 and increased expression of NQO1 and CuZnSOD proteins. Altogether, these findings point to an essential function for p62 in Nrf2‐dependent stimulation of antioxidant gene expression in response to exercise in oxidative muscle and suggest that phosphorylation of p62 at Ser351 plays an important role in this modulation. However, future studies establishing the degree to which Ser351 phosphorylation and other potential post‐translational modifications of p62 enhance its binding to Keap1 and improve Nrf2 activation in response to exercise are still required.

An interesting and unexpected observation was that regular exercise‐mediated increase of CuZnSOD and MnSOD expression in the glycolytic white vastus lateralis muscle was preserved in both Nrf2 mKO and p62 mKO mice. The precise mechanisms regulating the CuZnSOD and MnSOD gene expression in the exercising white vastus lateralis muscle remain to be determined. However, muscle fibers in the white vastus lateralis muscle switch to a more oxidative, slow phenotype in response to endurance exercise training, whereas this phenomenon does not take place in the already oxidative, slow‐twitch soleus muscle. In fact, muscle fiber‐type switching by regular exercise was clearly observed in white vastus lateralis muscle. It is therefore tempting to speculate that CuZnSOD and MnSOD are transcriptionally regulated in the exercising white vastus lateralis by pathways contributing to the fiber‐type switching that occurs with regular endurance exercise (26) and that those are independent of both p62 and Nrf2.

Robust defects in autophagy contribute to myofiber degeneration, muscle weakness, and mitochondrial dysfunction (26, 27), whereas modest impairments in the pathway prevent exercise training—mediated adaptations in skeletal muscle, limiting improvements in physical performance (28). Although p62 is a well‐known autophagy adaptor protein (29, 30), p62 mKO mice displayed normal muscle mass, myofiber structure, as well as LC3‐I and LC3‐II protein levels both at baseline and after regular exercise. These findings suggest that the attenuation of exercise‐mediated increase expression of antioxidant proteins seen in p62 mKO is unrelated to the p62 role in autophagy.

In summary, the present study demonstrates that enhanced muscle contractile activity increases antioxidant enzyme levels in oxidative skeletal muscle in association with elevated Nrf2 expression, nuclear translocation, and DNA‐binding activity. A critical molecular mechanism for Nrf2 nuclear translocation involves enhanced p62 phosphorylation at Ser351, which increases its binding affinity to Keap1 and leads to dissociation of Nrf2. Importantly, loss of p62 in muscle significantly reduced regular exercise‐mediated increase of antioxidant enzyme expression (i.e., CuZnSOD and EcSOD), mimicking observations in Nrf2 mKO mice. Altogether, these findings reveal an essential cooperation between p62 and Nrf2 in the regulation of antioxidant enzyme expression in oxidative skeletal muscle. These may have implications for the development of new therapies to preserve skeletal muscle mass and function in conditions that benefit from regular exercise, such as in aging and chronic metabolic and/or cardiac diseases.

ACKNOWLEDGMENTS

The authors thank Dr. Steven J. Burden (New York University, New York, New York, USA), Dr. Toru Yanagawa (University of Tsukuba), and Dr. Jingbo Pi (China Medical University, Shenyang, China) for their generosity in providing mlc1‐cre mice, p62 flox mice, and Nrf2 flox, respectively. The authors also thank Dr. Ichiro Miyoshi, Dr. Masayuki Yamamoto, Dr. Takahumi Suzuki (all from Tohuku University, Sendai, Japan) and Yasuo Kitajima (Kumamoto University, Kumamoto, Japan) for the transfer arrangements for the mice. The authors thank Yasuhiko Hayakawa (Nepa Gene, Ichikawa, Japan) for his excellent technical support in plasmid transfection. This study was supported by Grant‐in‐Aid for Research Activity Start‐Up (25882036), Grant‐in‐Aid for Scientific Research (B) (15H03080), Grant‐in‐Aid for Scientific Research (B) (18H03153), the Suzuken Memorial Foundation, Toyoaki Scholarship Foundation, The Nakatomi Foundation, and The Uehara Memorial Foundation (to M.O.). The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS

M. Yamada, M. Iwata, E. Warabi, H. Oishi, and M. Okutsu performed experiments; M. Yamada, V. A. Lira, and M. Okutsu interpreted results of experiments, prepared figures and tables, and wrote the manuscript; and M. Yamada and M. Okutsu conceived and designed the research and analyzed data;.